Definitions/Explanation : Gene & Split gene
Definitions/Explanation : Gene & Split gene
Gene is the functional unit of inheritance. The $DNA$ sequence coding for $rRNA$ or $tRNA$ molecule also define gene.
The gene with both exons and introns is a characteristic of eukaryotic $DNA$.
Similar Questions
A transcription unit in $DNA$ is defined primarily by the three regions in $DNA$ and these are with respect to upstream and down stream end;
A transcription unit in $DNA$ is defined primarily by the three regions in $DNA$ and these are with respect to upstream and down stream end;
- [NEET 2024]
Eukaryotic $RNA$ polymerase $III$ catalyse the synthesis of
Eukaryotic $RNA$ polymerase $III$ catalyse the synthesis of
Which one is the correct product of $DNA$ dependent $RNA$ polymerase to the given template?
$3$'$TACATGGCAAATATCCATTCA5'$
Which one is the correct product of $DNA$ dependent $RNA$ polymerase to the given template?
$3$'$TACATGGCAAATATCCATTCA5'$
- [NEET 2024]
Transcription
Transcription
If the $DNA$ strand has the nitrogenous base sequence $ATTGCC$, the $mRNA$ will have
If the $DNA$ strand has the nitrogenous base sequence $ATTGCC$, the $mRNA$ will have