A transcription unit in $DNA$ is defined primarily by the three regions in $DNA$ and these are with respect to upstream and down stream end;
Eukaryotic $RNA$ polymerase $III$ catalyse the synthesis of
Which one is the correct product of $DNA$ dependent $RNA$ polymerase to the given template?
$3$'$TACATGGCAAATATCCATTCA5'$
Transcription
If the $DNA$ strand has the nitrogenous base sequence $ATTGCC$, the $mRNA$ will have