Definitions/Explanation : Gene &  Split gene
 

Vedclass pdf generator app on play store
Vedclass iOS app on app store

Gene is the functional unit of inheritance. The $DNA$ sequence coding for $rRNA$ or $tRNA$ molecule also define gene.

The gene with both exons and introns is a characteristic of eukaryotic $DNA$.

Similar Questions

A transcription unit in $DNA$ is defined primarily by the three regions in $DNA$ and these are with respect to upstream and down stream end;

  • [NEET 2024]

Eukaryotic $RNA$ polymerase $III$ catalyse the synthesis of

Which one is the correct product of $DNA$ dependent $RNA$ polymerase to the given template?

$3$'$TACATGGCAAATATCCATTCA5'$

  • [NEET 2024]

Transcription

If the $DNA$ strand has the nitrogenous base sequence $ATTGCC$, the $mRNA$ will have